Thiruvananthapuram

(redirected from Trivendrum)
Also found in: Encyclopedia.

Thi·ruv·a·nan·tha·pu·ram

 (tē-ro͞o-ə-năn′tə-po͝or-əm)
See Trivandrum.
American Heritage® Dictionary of the English Language, Fifth Edition. Copyright © 2016 by Houghton Mifflin Harcourt Publishing Company. Published by Houghton Mifflin Harcourt Publishing Company. All rights reserved.

Thiruvananthapuram

(ˌθɪruːvəˈnæntæˌpuːrɑːm)
n
(Placename) the local official name of Trivandrum
Collins English Dictionary – Complete and Unabridged, 12th Edition 2014 © HarperCollins Publishers 1991, 1994, 1998, 2000, 2003, 2006, 2007, 2009, 2011, 2014
Mentioned in ?
References in periodicals archive ?
These vacancies are in Ahmedabad, Ajmer, Allahabad, Bangalore, Bhopal, Bhubaneshwar, Bilaspur, Chandigarh, Chennai, Gorakhpur, Guwahati, Jammu, Kolkata, Malda, Mumbai, Muzaffarpur, Patna, Ranchi, Secunderabad, Siliguri, and Trivendrum.
Goyal exhorts job aspirants to apply for 1 lakh railways jobs
Molecular Characterization of screened isolates - Genomic DNA was extracted, PCR was done with 16S rRNA gene specific primers (Forward primer, 5' a 3': CGAATTCGTCGACAACAGAG TTTGATCCTGGCTCAG and Reverse primer, 5' a 3': CCCGGGATCCAAGCTTACG GCTACCTTG TTACGACTT) and the PCR products were sequenced (Rajeev Gandhi Centre for Biotechnology, Trivendrum).
Identification and Characterization of Bacterial Isolates and their Role in the Degradation of Neonicotinoid Insecticide Thiamethoxam
Pattern of dermatological diseases in Trivendrum. Indian J Dermatol Venereol Leprol.
Pattern of dermatological disorders in a private skin clinic of Rohilkhand region in India
The conferences will be held at Mumbai, Bangalore, New Delhi, Chennai, Kolkata, Chandigarh, Hyderabad, Pune, Jaipur, Ahmedabad, Patna, Ranchi, Bhubaneshwar, , Panaji, Gandhinagar, Trivendrum, Cochin, Shimla, Dehradun Pondicherry, Lucknow & Agra.
BPO Association of India (BAI) Joins Hands with World BPO Forum - Announces BPO Awards

Dictionary browser ?
Full browser ?